Difference between revisions of "Talk:Ui-concepts.as"

From Organic Design wiki
(Put User interface concepts here for easy access)
("Hello, I'm a sponge" ECMA protoyping example)
Line 1: Line 1:
 
'''This script is compiled in the [[User interface concepts]] article'''
 
'''This script is compiled in the [[User interface concepts]] article'''
 +
----
 +
;Example: Using an object as a prototype
 +
<pre>
 +
// Create a constructor as a normal function
 +
// - use "this" to populate as if it were a method (which it will be)
 +
function animal( species ) {
 +
    this.species = species;
 +
    }
 +
 +
// Add the methods and properties you want instances of your prototype to inherit
 +
// to the "prototype" property of your constructor function
 +
animal.prototype.DNA = 'ACGATCCATGATCGTCGCATAGCTAGT';
 +
animal.sayHello = function() {
 +
    echo "Hello, I'm a " + this.species;
 +
    }
 +
 +
// Instantiate an instance of your object, and call a method
 +
bob = new animal( 'sponge' );
 +
bob.sayHello(); // output: "Hello, I'm a sponge"
 +
</pre>
 
----
 
----
 
<pre>create.panel = function( name, layer ) {
 
<pre>create.panel = function( name, layer ) {

Revision as of 04:02, 7 April 2006

This script is compiled in the User interface concepts article


Example
Using an object as a prototype
// Create a constructor as a normal function
// - use "this" to populate as if it were a method (which it will be)
function animal( species ) {
    this.species = species;
    }

// Add the methods and properties you want instances of your prototype to inherit
// to the "prototype" property of your constructor function
animal.prototype.DNA = 'ACGATCCATGATCGTCGCATAGCTAGT';
animal.sayHello = function() {
    echo "Hello, I'm a " + this.species;
    }

// Instantiate an instance of your object, and call a method
bob = new animal( 'sponge' );
bob.sayHello(); // output: "Hello, I'm a sponge"

create.panel = function( name, layer ) {
    this.createEmptyMovieClip( name, layer );
    return this[name];
    }

--Nad 21:10, 5 Apr 2006 (NZST)


I can't see why its not iterating through those output peroperties, it all seems perfectly fine....? --Nad 17:08, 4 Apr 2006 (NZST)

That's ok for now. I'm gonna focus on sorting out movieClip objects now (layers, containment and canvas size). Want to get some actual graphics happening from this prototype! --Rob 17:15, 4 Apr 2006 (NZST)

here's an example fragment with events from a working swf:

	hours.onPress = function() {
		this.nbrRotationInit = 0;
		this.nbrPosX = fncGetX(this);
		this.nbrPosY = fncGetY(this);
		var nbrMyRotation = fncGetRotation(this);
		this.nbrRotationInit = nbrMyRotation-this._rotation;
		this.onEnterFrame = fncRotate;
		_global.drag = 'hour';
		};
	hours.onRelease = hours.onReleaseOutside = function() {
		delete this.onEnterFrame;
		_root.updateTime();
		_global.drag = '';
		};
	hours.onMouseMove = function() {
		if (_global.drag == 'hour') {
			_root.minute._rotation = this._rotation*12;
			_global.hour = int((_root.hours._rotation+360)/30)%12;
			}
		};